1. Introduction:
2. Meeting announcements Lotus Symposium
report.
3. Lotus Activities:
reports and abstracts
4. Notes and news.
Purpose: The Lotus
Newsletter consists of informal communications of research
information on Lotus. Reports of any phase of research
on Lotus breeding, genetics, taxonomy, management, utilization
or physiology are welcome. Your biographic sketches and information
about your research objectives, approaches, and progress including
titles of your publications are encouraged. Seed requests and
news items are accepted.
This is the 25th year of publication for the Lotus
Newsletter. Now is the time to consider contributing to
the 26th volume of the Lotus Newsletter.
Contributions generally are compiled without editing.
1. Prepare your contribution using any Macintosh or IBM (MS-DOS) word processing program. Then you have two options:
a. submit the file on 3.5 " (90 mm) disk accompanied by a printed copy of the contribution. Identify which program you used. OR
b. submit the file to my e-mail address (pbeuselinck@plantsci.missouri.edu) and send me a hardcopy by FAX to 573-882-1467, or by regular mail.
2. Send your contributions by December 31, 1995 to:
Lotus Newsletter
Dr. P. R. Beuselinck, USDA-ARS
Plant Genetics Research Unit
207 Waters Hall
University of Missouri
Columbia, MO 65211 U.S.A.
E-Mail pbeuselinck@plantsci.missouri.edu
FAX 573-882-1467
The expense of publishing the Lotus Newsletter has been partially covered by unrestricted research support. This issue of the Lotus Newsletter is provided to you without charge. I will continue to strive for financial support of the Lotus Newsletter to provide you with an unencumbered communication resource.
Many thanks to you who respond to my requests for information about your Lotus research. Your contributions to the Lotus Newsletter help generate a better perspective of the research and management on the many species of Lotus.
There is a limited supply of back issues available. Supplies of most volumes have been depleted, but requests will be handled on a first-come first-served basis.
Your suggestions are helpful, and I will strive to incorporate them to make this publication more useful. As you compile your data for analysis please think about making a contribution to the Lotus Newsletter. Use the Lotus Newsletter as a resource for communication: it is published to aid you (and me), the international researchers of Lotus.
If you have not filled-out and sent in a questionnaire in the last two years please complete one. If you know of others interested in receiving the Lotus Newsletter have them submit a questionnaire and they'll be added to the mailing list.
Please note the instructions for submitting your contribution by computer disk or e-mail.
Requests for distribution the Lotus Newsletter to university or research libraries are accepted. If you have a library that needs a copy for your research group or center please notify me.
The illustration on the cover is of a Lotus spp. L. graciously provided by Ana Arambarri (Argentina) . The illustration of L. unifoliatus Benth. (syn. L. purshianus) is the third in a series of illustrations that started with L. edulis in Volume 23.
Name _______________________________________________________
Institute or Agency _____________________________________________
Mailing Address _______________________________________________
Mailing Address _______________________________________________
Mailing Address _______________________________________________
Country _____________________________________________________
Telephone Fax ________________________________________________
E-mail ______________________________________________________
Checkmark all categories that apply
to your area of Lotus research:
| O Genetics | O Breeding | O Taxonomy | O Physiology |
| O Pathology | O Ecology | O Biology | O Forage |
| O Utilization | O Germplasm | O Tissue culture | O Biotechnology |
| O Entomology | O Seed | O Reclamation | O Other (please indicate) |
List the Lotus
species you study: _______________________________
Give a brief description of your research _________________________
___________________________________________________________
Suggestions? _______________________________________________
Send or FAX your completed questionnaire to:
P. R. Beuselinck, USDA-ARS
University of Missouri
207 Waters Hall
Columbia, MO 65211 USA
FAX 573-882-1467
The 1st International Lotus Symposium was held at the Missouri
Botanical Gardens in St. Louis, Missouri, USA on 2224 March
1994. The Lotus Symposium was cosponsored by the
Missouri Botanical Society, the University of Missouri, the Agricultural
Research ServiceUSDA, the American Society of Agronomy,
and Crop Science Society of America. The main objective of the
Lotus Symposium was to discuss what is known about the
many basic and applied disciplines of this genus including breeding,
genetics, taxonomy, management, utilization, physiology, and pathology
from applied agronomy to genetic manipulation. The secondary objective
was to organize the proceedings in a manner so that they could
be used as the a standard reference for Lotus and as the
base for developing a monograph on Lotus.
Comments received during and after the symposium from the more
than 60 registrants were quite complimentary. The weather cooperated
with the springtime urges of the plantings at the Botanical Gardens
resulting in a daily changing floral scene. Over 40 papers were
presented during the 2.5 days of the symposium. The papers that
were actually presented are listed below. Other papers were submitted
and will be found in the proceedings of the symposium, but due
to travel or funding complications the authors were not able to
attend.
An ad hoc committee was formed to initiate and coordinate
the timing and location of a second Lotus symposium. Members of
the committee are: P. R. Beuselinck (USA, Chair), M. Blumenthal
(Australia), P. Gayraud (France), M. Jay (France), K. Urbanska
(Switzerland), and Y. Papadopoulos (Canada). Suggestions or offers
can be made to any member of the committee.
Joseph H. Kirkbride, Jr: Taxonomic circumscription of the
genus Lotus Linnaeus (Fabaceae, Loteae), its tribal position,
and its species.
William F. Grant: Interspecific hybridization and amphiploidy
of Lotus as it relates to phylogeny and evolution.
Maurice Jay, Joel Reynaud, D. Cartier, and S. Blaise: Diversification
strategies of Lotus corniculatus s.1. in the light of chemical
markers.
Joel Reynaud and Maurice Jay: Phytochemical approach to
Lotus corniculatus s.1. diversification.
Stephanie L. Greene and James R. McFerson: Conservation
of the Lotus genetic resources: Status of the U.S. collection.
Jeffrey J. Steiner: Lotus germplasm utilization:
Integrating genetic diversity, species relationships, and ecological
distributions.
Robert G. Gregorson, D. LowellRobinson, and Carroll P.
Vance: Carbon and nitrogen metabolism in Lotus.
Thomas J. Wacek: Rhizobium species associated with Lotus.
C. Jerry Nelson, S. N. Hur, and Paul R. Beuselinck: Physiology
of seedling vigor of birdsfoot trefoil.
D. O. Gimenez and Pedro A. Ballatti: Lotus tenuis plant
growth and development under different environmental conditions.
Daphne T. Fairey: Seed production in birdsfoot trefoil,
Lotus spp.: A review of some limiting factors.
Clara C. Heyn, A. Madmony, G. Alon, and E. Werker: Regulation
of the breeding systems of some selfcompatible Lotus species.
Richard R. Smith. David K. Davis, and William H. Leakey:
Birdsfoot trefoil seed production in northern United States.
Kristi L. SavageClarke, Robert L. McGraw, and Paul R.
Beuselinck: Stigma receptivity in birdsfoot trefoil.
M. M. Mujica and C. P. Rumi: Cotyledon influence on the
initial growing stage of L. tenuis.
Phillip Morris, K. Judith Webb, Mark P. Robbins, and Leif Skot:
Application of tissue culture, molecular biology and genetic
manipulation in Lotus research
M. Niizeki, R. Ishikawa, T. Harada, and K. Saito: Cytogenetical
and molecular genetical analysis on somaclonal variation in Lotus
corniculatus.
Jens Stougaard: Lotus japonicus a model legume.
K. Judith Webb, Mark P. Robbins, and Sue Mizen: Segregation
of Agrobacterium rhizogenes TDNA from other inserted genes
in the T1 progeny of Lotus corniculatus.
Mark P. Robbins, Tom R. Carron, Steven P. Colliver, and Phillip
Morris: A study on the genetic manipulation of flavonoids
and condensed tannins in the Lotus corniculatus using antisense
technology.
Martin J. Blumenthal, Walter J. Kelman, W. L. Lowther, and
Kenneth H. Widdup: The use and management of Lotus in
Australia and New Zealand.
Robert L. McGraw: Agronomic uses of Lotus in North
America.
Ariel Asuaga: Use and production of Lotus corniculatus
in Uruguay.
Carl S. Hoveland: Birdsfoot trefoil management problems
in a stressful environment.
Ariel Asuaga: Lotus subbiflorus cv E1 Rincon, a
new alternative for extensive improvements of natural pastures.
Joseph L. Moyer, D. W. Sweeney, and D. A. Whitney: Phosphorus,
potassium, and chloride effects on birdsfoot trefoil and alfalfa.
A. M. Quadrelli de Escuder, F. Laich, and Y. Andreoli:
Response of Lotus tenuis to inoculation with Rhizobium
loti and to fertilization with phosphorus.
Osvaldo R. Vignolio, Osvaldo N. Fernandez, and N. O. Maciera:
Response of Lotus tenuis and Lotus corniculatus
to flooding in seedling stage.
Gary S. Banuelos, S. Zambrzuski, S. Akohoue, and P. Beuselinck:
Remediation of selenium and boron contaminated soil with Lotus
corniculatus L.
Krystyna M. Urbanska: Use of Lotus alpinus in alpine
ecosystem restoration
Paul R. Henderlong: Birdsfoot trefoil in Conservation Reserve
Program (CRP) areas.
James T. English: Diseases of Lotus spp
Craig Roberts, Art Karr, M Mohammadi, Stephen Marek, and Paul
Beuselinck: Chitinases in Lotus corniculatus L.
A. Bazin, S. Blaise, and D. Cartier: Polymorphism study
of two defense mechanisms in French populations of Lotus corniculatus
L.: Cyanide and condensed tannins.
Nora Altier: Current status of research on Lotus diseases
in Uruguay.
L. Choa, J. De Battista, and F. Santiaque: Incidence of
birdsfoot trefoil crown and root rot in west Uruguay and Entre
Rios (Argentina).
S. Stewart, F. Formoso, and N. Altier: A flower blight
of birdsfoot trefoil, caused by Colletotrichum acutatum.
Paul R. Beuselinck: The rhizomes of Lotus corniculatus
L.
Nancy J. Ehlke, Paul R. Beuselinck, and Robert L. McGraw: Evaluation
of birdsfoot trefoil populations selected under grazing.
Yousef A. Papadopoulos, K. L Sutherland, J. Novak, K. B. McRae,
and S. A. E. Fillmore: Assessment of phenotypic recurrent
selection techniques for improving vigor in birdsfoot trefoil.
John R. Samek and P. R. Beuselinck: Lotus corniculatus
L. diploids and their hybridization with L. tenuis Waldst
& Kit. ex Willd.
The First International Lotus Symposium Proceedings will
be available until June 1, 1995 through the University Extension
Conference Office. Cost is: $17 (US) $20 (outside the US)
Payment will be accepted by Purchase Order, Credit Card or check
made out to: UNIVERSITY OF MISSOURI and sent to: Lotus Proceedings
344 Hearnes Center Columbia, MO 65211.
If you wish to contact the University Extension Conference Office
they can be reached: by phone (314) 8824038 by fax (314)
8821953
After June 1, 1995, contact Paul Beuselinck at pbeuselinck@plantsci.missouri.edu
for information.
Introduction
During the last three decades many Lotus species (represented
by at least 60 separate introductions) have been grown at Grafton
Agricultural Research and Advisory Station. Lotus pedunculatus
and Lotus corniculatus have been the most potentially useful
species. However, to date, the only commercial Lotus species
used on a large scale in Australia is the Lotus pedunculatus
cultivar from New Zealand, Grasslands Maku.
In 1974, the Regional Research Agronomist, Mr A.D. O'Brien, began
a detailed study of the Lotus genus. Evaluation of his collections
led to the selection of three vigorous, early flowering types
of Lotus pedunculatus from the Algarve region of southern
Portugal between Caldas de Manchique (latitude 37°9'N) and
Manchique (latitude 37°ll'N).
The collection site was a rugged but protected 30% slope, with
an easterly aspect and a gravelly soil, derived from granite (pH
6.0). It was kept wet by spring fed soakages. Average annual rainfall
was 850mm (O'Brien, 1974).
These three selections (CPI 67676, CPI 67677 and CPI 67678) were
combined and evaluated as the composite P15303, in trials at Kempsey
and Grafton in northeastern New South Wales (Wilson, 1980)
and near Gympie in southeastern Queensland (Cook, 1984 and
1985). P15303 had an extended flowering period which complicated
management for seed production. To overcome this, seed produced
from the original accession, CPI 67677, was sown under isolation
in 1984. Very early flowering plants were eliminated from the
population to produce Sharnae, which as a more restricted flowering
period.
Morphological comparison with Grasslands Maku
Sharnae is morphologically similar to Grasslands Maku, except
that it is a less hairy plant. At flowering, the buds of Grasslands
Maku are densely hairy, the matted hairs almost obscuring the
calyx teeth. There are fewer hairs on the calyx of Sharnae and
the outlines of the spreading teeth are clearly visible. The peduncle
tip is also much less hairy than that of Grasslands Maku.
Table 1 demonstrates that Sharnae produced
fewer crown stems per plant than Grasslands Maku in a glasshouse
study of 200, one month old, plants. Similarly in a study of one
month old plants gown on a low fertility podsolic soil at Grafton,
Sharnae produced slightly fewer rhizomes than Maku.
Seeds of Sharnae are smaller and almost double the number per
pod of Grasslands Maku. Sharnae is diploid (2n=12) (W.Kelman,
pers. comm.) and Grasslands Maku is tetraploid (Armstrong, 1974).
Sharnae is more robust and bulky than Grasslands Maku.
Table 1 Morphological comparison of Sharnae with Grasslands Haku
| Leaf colour | |||
| Time of flowering | |||
| Condensed tannins | |||
| Crown stems/plant | |||
| Rhizomes/plant | |||
| Seed size (mm) | |||
| Seed weight | |||
| Seeds per pod |
Agronomy
Flowering Time: The main difference between Sharnae and
Grasslands Maku is their time of flowering. On the New South Wales
north coast Sharnae commences flowering in mid September, reaches
its first peak by mid October and continues waves of flowering
until late summer. By contrast, Grasslands Maku rarely flowers
before mid December. Mature seed has been collected from predominantly
rain grown Sharnae at Grafton during each month from mid November
to mid April.
This characteristic is particularly important in the subtropical
regions, where the ability to mature seed before the summerautumn
wet season can enhance survival, through seedling recruitment
following flooding of coastal lowlands.
Forage yield: In trials on two soil types at Grafton, Sharnae has given higher forage yields during late spring and early summer than Grasslands Maku. In continuously grazed trials on two sites with contrasting moisture regimes at Fineflower, in the upper Clarence Valley, Sharnae has persisted better, spread further and produced more dry matter than Grasslands Maku on the driest site. Conversely, Grasslands Maku had superior persistence, spread and yield on the moist site (Table 2). Evaluation of 40 lines of Lotus pedunculatus at 3 sites (Canberra, Bowral and Nowra) has shown Sharnae to be in the top 10 lines for dry matter production at all sites (Blumenthal, pers. comm.).
Table 2 Agronomic comparison of Sharnae with
Grasslands Maku
| Site |
|
| |||||
| Moist | |||||||
| Dry | |||||||
Forage quality: The concentration of condensed tannins
in Sharnae varies between sites and with seasons but is
usually double that of Grasslands Maku. The tannin levels in Sharnae
may negatively affect voluntary intake and dry matter digestibility,
however in a mixed pasture the lotus component is unlikely to
be sufficiently dominant for this to have any major effect.
Data from trials at Wingham demonstrated little difference between
the digestibility of Sharnae and Maku, although Sharnae was in
full flower at sampling. Sharnae had 69.0% digestible dry matter
and Maku 73.6%.
Disease resistance: Limited data has shown Sharnae to have
resistance to root knot nematode (McLeod, pers. comm.) whereas
Maku is susceptible. This may be an important consideration affecting
the choice of Lotus cultivars for use as permanent ground cover
in subtropical orchards, plantation crops and pastures on acid,
sandy soils.
Herbicide tolerance: At Gympie, Sharnae was screened for
tolerance to a wide range of postemergent herbicides, including
some unregistered chemicals. It tolerated the full range of selective
grass herbicides available when applied at the recommended rates,
but failed to tolerate any of the standard range of broadleaf
herbicides (Lock and Harvey, 1990).
Seed production: Sharnae's advantage in northern NSW and
southern Qld coastal belt is that it can produce seed at latitudes
as low as 26S while Maku cannot. This is a valuable characteristic
of Sharnae to the Australian seed industry. The seed yields of
Sharnae from irrigated plots at Grafton have been between 300
and 350 kg/ha, of which the hard seed content varies between 35
to 45%.
References
Armstrong, C.S. (1974) Grasslands Maku a tetraploid lotus
(Lotus pedunculatus). New Zealand Journal of Experimental
Agriculture, 2, 333336.
Cook, B.G. (1984) Near North Coast Observation Programme. In Pasture
Agronomy Technical Report 1984. Qld Department of Primary
Industries, Brisbane, pg 60.
Cook, B.G. (1985) Near North Coast Observation Programme. In Pasture
Agronomy Technical Report 1985. Qld Department of Primary
Industries, Brisbane, pg 63.
Loch, D.S. and Harvey, G.L. (1990). In The Proceedings of a
Herbicide Workshop, Toowoomba, 1719th January 1990.
Qld Department of Primary Industries, Mareeba. Pages 234
to 242 and Appendices pages 3 to 6.
O'Brien, A.D. (1974). A plant collecting trip in the Western Mediterranean
region of southwest Spain, southern Portugal and northwest
Morocco. Churchill Fellowship Report.
Wilson, G. (1980). Lotus on the north coast. NSW Department
of Agriculture Aanote 9/80.
GROWTH CHARACTERISTICS AND PHOSPHATE RESPONSE
OF THREE LOTUS SPECIES
New Zealand Pastoral Agriculture Research Institute Ltd Whatawhata
Research Centre Private Bag 3089, Hamilton, New Zealand
Introduction
The agronomic evaluation of three Lotus species was conducted
as part of a larger experiment screening a number of temperate,
mainly annual, legume species from the Lotus, Medicago, Ornithopus
and Trifolium genera. The objective of this trial was
to evaluate the ability of a number of pasture legume species
to grow in a low fertility, low pH hill country soil; to assess
their growth response to added phosphate (P); and to use information
on growth patterns and reseeding to assess their suitability for
a hill soil in a summerdry environment. This environment
represents approximately 4 million ha of pastoral land in the
North Island of New Zealand.
The three Lotus species included in the experiment were:
Lotus angustissimus L.: (slender birdsfoot trefoil) Annual/perennial.
Material used: accession S2778
Lotus subbiflorus Lag. syn. L. suaveolens Pers.:
(hairy birdsfoot trefoil) Annual/perennial. Material used: cv.
'E1 Rincon' (Uruguay)
Lotus tenuis Waldst. et Kit.: (narrowleaf trefoil)
Perennial. Material used: accession S2840
Methods
The system utilised in the evaluation of the species involved
in the experiment consisted of growing plants in undisturbed soil
monoliths which were removed from the field site encased in PVC
tubes. The technique was adapted from that used for nutrient leaching
experiments in lysimeters. This allowed for a reasonable degree
of control of water and nutrients while also providing conditions
close to those likely to be encountered by plants in/under the
field, allowing for full expression of the plants normal growth
habit. The soil type used in this experiment is known locally
as a Dunmore ash soil (Yellowbrown loam/alvic soil). This
soil type generally has pH = 5.4; Olsen P = 10; P retention =
9095%.
The uniformity of growing conditions in each core was evaluated
by firstly taking soil samples from immediately outside the circumference
of each core (at the field site) for soil chemical analysis. The
second phase involved growing two 'calibration' plants in each
core prior to planting the annual species: cloned material of
'Grasslands Huia' white clover (Trifolium repens L.) and
'Warigal' wheat (Avena sativa L.). These test plants were
transplanted into the cores and measurements of plant growth were
made.
The Lotus seeds were pregerminated by scarifying
with sandpaper, inoculated with appropriate strains of rhizobia,
and transplanted into the soil cores in late June after eight
weeks of growth. Three plants were planted in each core. Two phosphate
treatments were applied across all species as follows: 0 and 100
kgP/ha equivalent applied to the core surface in solution.
In order to simulate summer drought stress during the later development
of the plants, irrigation was ceased in late November and the
prevailing weather conditions allowed to dictate soil water levels.
The growth of plants through winter and early spring was assessed
by counts of growing points. Plant harvests on all cores were
made at 45 week intervals, depending on growth rates, beginning
in late September. Plants were cut to a height of 1.0 cm, and
to 1.0 cm inside the core circumference. The cut herbage was dissected
into leaf, flower and seed pod components for dry matter determination,
and flower and pod numbers were counted from harvested material.
The dried herbage from harvest two was bulked within species and
analysed for the major plant minerals N, P, K, S, Na, Mg, and
Ca. The date on which individual plants had senesced sufficiently
to be regarded as dead was recorded.
Results and Discussion
Analysis of the results of the initial soil testing adjacent to
the cores, and the growth of the indicator plants, showed no significant
differences between the factors 'P treatment' or 'species'. Since
this indicated a good degree of uniformity amongst the cores it
was not considered necessary to use these results to alter the
design or as a covariate measure.
L. angustissimus appeared to have the earliest growth,
by virtue of having consistently around 10 more primary growing
points than the other two species, (Table 1)
along with growing the most herbage at the first harvest (Fig. 1).
By contrast the growth of the perennial L. tenuis was significantly
less than the two annuals through most of the season and did not
exceed that of the annuals until February. These differences between
the species were significant for all harvests at p<O.O 1.
L. angustissimus also had the earliest flowering period
(Table 1), although in terms of total flowers (both counted and
harvested) L. subbiflorus was the most profuse, followed
by L. angustissimus and L. tenuis. This ranking
also carried through into the number of pods harvested, the species
differences being significant at p< 0.05.
Completing the pattern, L. angustissimus was the first
species to senesce and die, in late January compared to late February
for L. subbiflorus. This measure was not relevant to the
perennial L. tenuis.
For any annual species, time of flowering is a critical factor
in successful seed production and regeneration. In the summerdry
North Island hill environment, completion of flowering and adequate
seed development must take place before the onset of a somewhat
unpredictable dry period. In this context, the early pattern of
growth in L. angustissimus appears to be most welladapted.
Weather conditions over the DecemberMarch period of 199293
were slightly below average for rainfall, and close to average
for temperatures. Thus in terms of the impact of the summer dry
period on plant growth, seed production and senescence, this season
proved to be a representative one. The successful growth and seed
producton of all three species in this trial indicates their ability
to regenerate in the field under average conditions.
In terms of total herbage growth, all three species had significant
responses to added P (Table 1) although the
size of this response differed. The high added P treatment overall
gave an increase of 105% for L. angustissimus; 21% for
L. subbiflorus; and 59% for L. tenuis. The data
from individual harvests showed that this significant response
to P occurred only in the months of November, December and January
(Fig. 1), and in fact the interaction
between 'species' and 'P' was only significant for the November
harvest.
While the greatest response to added P came from L. angustissimus,
it should be noted that smaller responses to added P can be
considered an indicator of adaptability to low P levels as is
the case with L. subbiflorus. This species was able to
maintain a high level of growth at low P levels relative to its
'potential' given unlimiting P availability, this being the intent
of the high P application rate. Thus this species can be regarded
as well suited to the low P fertility soils targetted in this
screening.
Although added P had no significant effect on flower and pod numbers,
there appears to be a consistent pattern in these measurements
for L. angustissimus and L. tenuis to increase numbers
of reproductive heads in response to P, in contrast to a decrease
for L. subbiflorus. In addition, improved P fertility
appears to have significantly accelerated senescence (Table l).This
latter result is somewhat unexpected, yet implies an overall preference
of this species for low P fertility conditions.
Conclusions
In terms of the question of the suitability of species for a low
fertility, moderately acid hill soil environment under intensive
grazing, the results of this screening trial indicate that L.
angustissimus and L. subbiflorus are potentially
well adapted, L. subbiJlorus being particularly well adapted
to conditions of low soil phosphate fertility.
Table.1 Growth characteristics of three Lotus species
| Species | L. angustissimus | L. subbiflorus | L. tenuis | SEM | ||||
| Phosphate level | P(O) | P(100) | P(0) | P(100) | P(0) | P(100) | ||
| Primary growing points(per core in midSept.) | 35 | 37 | 25 | 25 | 21 | 21 | 1.3 | |
| Total Herbage (gDM harvested per core) | 13.3 | 27.3 | 23.5 | 28.4 | 13.6 | 21.5 | 2.6 | |
| Total flowers (number harvested per core) | 117 | 171 | 281 | 210 | 48 | 82 | 36 | |
| Total pods (number harvested per core) | 187 | 175 | 308 | 173 | 93 | 144 | 38 | |
| Flowering period | ||||||||
| Mean death date | 1/26/93 | 251/93 | 3/4/93 | 2/17/93 | * | * | 2-days | |
Competitiveness of birdsfoot trefoil, kura clover, and lading
clover with tall fescue
Osceola ladino clover, AU Dewey birdsfoot trefoil, and Rhizo kura
clover were grown in monocultures and in mixtures with AU Triumph
tall fescue with adequate water and under water stress in the
greenhouse. Kura clover was more severely affected by competition
from tall fescue than either ladino clover or birdsfoot trefoil.
Under soil moisture stress, birdsfoot trefoil was more competitive
than lading clover when grown in mixture with tall fescue.
Tall fescuelegume mixture performance on a soil with
a compacted plow sole layer.
Alfagraze alfalfa, AU Dewey birdsfoot trefoil, and Osceola ladino
clover were grown in monoculture and in mixture with AU Triumph
tall fescue on a Cecil clay loam soil having a 1inch compacted
layer at a depth of approximately 6 to 8 inches. This is a common
problem on this soil and chisel tillage has only a short period
of improvement before the soil seals again. The field experiment
was conducted over a 3year period near Athens, GA. Harvesting
was done at monthly intervals. Tall fescue monoculture was fertilized
four times with 50 lb N/acre each year Rainfall was good the first
two years, followed by extreme drought in 1993.
| Entry | 1991 | 1992 | 1993 | 3yr average |
| Ladino clover + fescue | 6769 a | 4964 ab | 1836 a | 4523 a |
| Alfalfa + fescue | 4513 d | 4938 ab | 1824 a | 3757 b |
| Trefoil + fescue | 4688 cd | 2978 c | 1798 a | 3155 c |
| Ladino clover only | 5432 bc | 3905 abc | 723 b | 3165 c |
| Alfalfa only | 3529 e | 4665 ab | 1906 a | 3367 bc |
| Trefoil only | 4141 de | 3874 bc | 1826 a | 3280 bc |
| Tall fescue + N | 5856 ab | 5012 a | 2196 a | 4355 a |
Means in a column followed by the same letter are not significantly
different at the 5% level
On this compacted soil, yields of all legumes were low. Root penetration
of the compacted zone by alfalfa was minimal. Ladino clover thrived
on this soil the first two years when rainfall was high but lost
stands during the severe drought the third year. Birdsfoot trefoil
and alfalfa stands persisted well. Since the yield potential of
alfalfa was not utilized on this soil, birdsfoot trefoil would
appear to be an economical replacement legume with lower inputs
of lime and fertilizer needed.
By the result of many earlier observations the fodder and seed
yield of L. corniculatus depend on sowing rate, weed controll
status and harvesting rate.
In Hungary at Szarvas where natural precipitation and the
relativ humidity are low levels in Summer time we are able to
grow L. corniculatus for forage and seed, but there are more convenient
territories for this purposes too.
In our trial have been tested the effects of factors in question.
In the sowing year we cut one time, in next two years (1992, 1993)
the seed yield harvesting utilized on second growth.
The yields of first cut air dried fedder and seed can be seen
at 1 st. table. As it shown the higher sowing
rate, the utilization of imazetapyr (PIVOT 100 LC) and the cutting
after flowering had better effects than lower rate, no herbicide
control! and cutting before flowering. Result of seed yield are
altering, future research need to make in this question.
In connection of weeding of sowing year (1991) can be stateilafter
the imazetapyr weed controll strongly decreased the percent of
broad leaf weeds, at higher sowing rate the percent of grass weed
too, but increased the number of Cirsium arvense, 2nd table.
The effects of different sowing rate, weed controll system and cutting date of the fodder and seed yield of L. corniculatus c.v. G keskenylevelu (19911993 at Szarvas).
Herbicide air dried fodder yield dkg/m2
Seed yield g/m2
| Sowing | ||||||||
| raate kg/ht |
Date of first cutting. (1992-1993) before flowering
| 7,6 | ||||||||
| 7,6 | ||||||||
| 15,2 | ||||||||
| 15,2 | ||||||||
| LDS 5 % |
Date of first cutting. (1992-1993) after flowering
| 7,6 | 0 | - | 3,49 | 80,69 | 43,95 | 128,13 | _xx | 30.49 |
| 7,6 | imazetapyr | 80 | 4,80 | 88,92 | 55,13 | 148,85 | - | 23.62 |
| 15,2 | 0 | - | 4,54 | 87,87 | 53,29 | 145,70 | - | 34.54 |
| 15,2 | imazetapyr | 80 | 7,76 | 104,80 | 69,74 | 182,30 | - | 33.45 |
| LDS 5 % | - | - | 1,37 | 8,19 | 10,71 | 15,63 | - | 6.42 |
| LDD 5 | - | - | - | - | - | - | - | 5.28 |
Note: x-as PIVOT 100 LC herbicyd
xx -there were not seed yield
xx -between any two combination
NS-Not significant
Weeding rate at the sowing year(1991 at Szarvas).
| Broadleaf | Cirsium arvense | Total | Broad leaf | Cirsium arvense | |||||
Note:
x 0 no treatment, 1. imazetapyr treatment
xx by the base of total weed amount
Birdsfoot trefoil (Lotus corniculatus L.) is the most important
forage legume in Uruguay, where it is grown for grazing alone
or in mixtures with grasses. The advantages of being a nonbloating
pasture, adapted to many different soil types and conditions (low
fertility, low pH, poor drainage), make this species suitable
for both intensive and extensive production systems along diverse
ecological regions of the country. The use of birdsfoot trefoil
could be increased if highly productive stands could be established
and maintained for several years.
The results of "Doomsday" experiments (disease and pest
protected plots), which were started in 1985, have indicated that
diseases play an important role limiting the birdsfoot trefoil
production in Uruguay, by reducing yield and persistence.
In the fall of 1987, a spaced plant nursery was established at
INIA La Estanzuela, to determine the main causal agents of birdsfoot
trefoil diseases. By the end of the first summer (April 1988),
20% of the plants had died; by the end of the second summer (April
1989), 85% of the plants had died; by June 1989, only 7% of the
plants had survived. Plant losses were almost entirely due to
crown and root diseases (rot/wilt). The key symptom of root or
crown infection was the failure of the plant to regrow after being
clipped. Many diseased plants also showed symptoms of injury by
root feeding curculio (Graphognatus leucoloma), which probably
enhanced infection by soil pathogens. The fungi involved were
mainly Fusarium spp., F. oxysporum being the most
prevalent followed by F. solani. In some casesRhizoctonia
solani was isolated from diseased plants.
Plants showing dwarf, witches' broomlike symptoms, probably
induced by Mycoplasmalike organisms (MLO's), represented
up to 15% of the stand. Diseased plants rarely produced flowers,
and prematurely died .
Stem and foliar diseases caused by Phoma spp., Cercospora
spp., Colletotrichum spp., Phomopsis spp., Stemphylium
spp., Myrothecium spp., and Uromyces spp. were
recorded with variable damage severity depending on seasons and
weather conditions. Lepthosphaerulina,spp. and Curvularia
spp. were detected in pods and seeds.
During field surveys, other minor diseases have been detected
on Lotus spp., causing variable damage. Sclerotium rolfsii,
has been found on L. corniculatus diseased plants during
occasionally hot, dry summers. In 1986 Sclerotinia spp.
was isolated from diseased plants of L. corniculatus and
L. subbiflorus the specially wet and cool conditions of
that spring favored the development of the disease. During the
fall of 1993, Sclerotinia was also detected causing a severe
rot in L. pedunculatus. specific weather conditions.
Longterm goals of our research project are to develop an
integrated management system to minimize the impact of diseases
on birdsfoot trefoil, for different production systems. To accomplish
these goals, current and future research focuses on three major
areas:
1. survey and diagnosis of diseases under different production
systems;
2. develop methods (inoculation techniques, rating scales) for
identifying and breeding resistances to main birdsfoot trefoil
diseases;
3. determine the effect of crop production practices on severity
of birdsfoot trefoil diseases.
A flower blight on birdsfoot trefoil (Lotus corniculatus
L.) occurred in 1991, 1992, and 1993. This legume is one of the
major forage crops sown in the country either for grazing and
seed production purposes.
A fungus of the genus Colletotrichum was consistently associated
and isolated from necrotic petals when wet weather prevailed during
flowering onset. The fungus was sent to the International Mycological
Institute in London, where it was identified and described as
Colletotrichum acutatum, (IMI No. 353322).
Pathogenicity tests were carried out during 1993, the symptoms
were reproduced and the pathogen was reisolated from the inoculated
flowers. Disease may result in important economical losses as
it might limit seed production. Inflorescences are mummified and
practically no pods arise from infected flowers.
No reports were found of this pathogen affecting L. corniculatus,
but it is a major fungus involved in strawberry anthracnose (causing
flower blight and fruit rot).
Field studies will be conducted to determine severity and yield
losses, and efficiency of commercial fungicides.
Introduction
Most common fruit in Lotus is the dehiscent legumen at
maturity by two twisting valves; however, there are species with
indehiscent pods. The purpose of this report was to establish
the structural differences between L. conimbricensis with
indehiscent, strongly upcurved fruit and L. corniculatus and
L. tenuis with dehiscent, terete and straight pods.
Materials and Methods
Completely developed fruits were used. They were from plants growing
in the Area de Genetica, Departamento de Biologia y Ecologia,
Facultad de Ciencias Agrarias y Forestales, U.N.L.P.
First, observations of pod structures were made on longitudinal,
transversal and diagonal handsections, stained with saffranin
and mounted in glycerin 90%; then, the fruits were examined on
the basis of microtome sections using FAAfixed material.
For microtoming fixed material was dehydrated through an alcoholic
series. Sections were cut at 15 µm thickness with a rotary
microtome, following standard paraffin methods. Sections were
stained with cresylviolet 1%, then mounted on glassslides
with balsam.
For SEM studies, fruits without treatment were mounted on stubs
with nail paint and coated with goldpalladium in a JFC1100.
Observations were made at 15Kv with a Jeol JSMT100 scanning
electron microscope.
Description
Pericarp structure was found to be as follows:
Exocarp: waxy surface; without trichomes; stomatas showed
a wide and raised outer rim and aperture long, in surface view.
In crosssection epidermal cells showed external thick walls
(sclerified); hypodermal cells were elongated with thin walls.
Mesocarp: parenchymatous tissue carrying the vascular bundles
and may be found crystalifer cells. Adjacent to the outer epidermis
at pericarp adaxial (ventral) suture and abaxial nerve level,
there is a sclerenchymatous tissue with fibres running parallel
to the longitudinal axis of the valves.
Endocarp: sclerenchymatous stratum along both fruit sides
with fibres running diagonally to the longitudinal axis of the
pod; this stratum is followed by parenchymatous cells; the innermost
layer (inner epidermis) with cells thinwalled.
Results
L. conimbricensis showed several fiber layers at pericarp adaxial suture and abaxial nerve level; these fibres present uniformly thick walls.
L. corniculatus and L. tenuis legumens
showed at pericarp adaxial suture and abaxial nerve level,
only a few cells with thick external and thin internal walls.
Discussion
Fahn and Zohary (1955) reported: "for an active dehiscence
of the leguminous pod, two factors are necessary": (1) the
crossing of the sclerenchymatous cells or/and the crossing of
their cellulose micelles; (2) the presence of a separation tissue
extending in the region of the suture from the inner to the outer
epidermis".
L. conimbricensis fruits do not have tissue separation, this character
would be determining indehiscence in the legumen, but other features
must be present. I hope pod shape and persistent style are important
characters. Pod structure in L. scoparius, presents tissue separation
at pericarp adaxial suture level, however it is an indehiscent
legumen; this species and others from Subgenus Syrmatium show
arcuate fruits and persistent style.
I think, these are interesting characters, because the pod from
Subgenus Syrmatium may be legumen folliculiforme (primitive character)
or indehiscent legumen, fewseeded (advanced characters)
following the report developed by Dudik (1981) and the research
on pod anatomy by Pate & Kuo (1981).
Literature
DUDIK, N.M. 1981. Morphology of the pods of Leguminales (Fabales).
Advances in legume systematics. (Ed. R.M. Polhill and P.H. Raven).
Part 2:897901.
FAHN, A. and M. ZOHARY. 1955. On the pericarpial structure of
the legumen: Its evolution and relation to dehiscence. Phytomorphology
3:99111.
PATE, J.S. and J. KUO. 1981. Anatomical study of legume pods
a possible tool in taxonomic research. Advances in legume systematics.
(Ed. R.M. Polhill and P.H. Raven). Part 2:903912.
Legume seeds will not frequently imbibe water and they fail to
germinate, even when environmental conditions are favorable for
germination. Those seeds are commonly called impermeable or hard
seeds. Impermeability of hard seeds testa is a physical exogenous
dormancy (Nikolaeva, 1969; Rolston, 1978). Lotus corniculatus
seedlots had a high percentage of impermeable seeds (MacDonald,
1946; Brown, 1955). The presence of hard seeds has also been determined
in the case of Lotus tenuis, in fact more than 90% were
found in samples free from the abrassive effect of the mechanical
threshing (Minon et.al., 1990; Mujica y Rumi, 1991). Seeds from
this species were found to have turned permeable after several
months preservation at low temperature conditions, in a refrigerator
(Mujica and Rumi, 1991). This treatment is slow although favorable
to preserve seed viability.
For many years, several methods have been used in order to draw
out impermeability in seeds of different species. One of them
is the mechanical scarification, abrassion by rough surfaces,
probably the most common commercial treatment (Rolston, 1978).
Chemical scarification with concentrated sulphuric acid (Hopkins,
1923) has been used experimentally, on many species. The time
during which seeds must be submerged for the treatment to be effective,
depends upon the species treated.
An aggressive scarification treatment may cause damage to the
seeds affecting their viability, germination rate or seedling
growth. Nothing on this matter has been informed yet for L.
tenuis.
Germination of L. tenuis seeds subject to scarification
with concentrated sulphuric acid during 10, 20 and 30 minutes,
and scarified by rubbing against sandpaper was assessed. For this
experiment, seeds from Tresur Chaja variety and from a natural
population in Brandsen, Province of Buenos Aires, were used. They
were harvested and threshing by hand in order to avoid erosion
on the teguments. For chemical scarification, seeds were soaking
in concentrated sulphuric acid during the previously determined
time. After exposure to acid, the seeds were washed with running
water for 5 minutes. Mechanical scarification was performed by
rubbing the seeds softly but constantly between extrafine
sandpaper during 3 minutes. A nonscarified control sample
was also included. Design used was a completely randomized, with
4 repetitions. Fifty seeds were placed into each petri dish, they
were incubated at 22°C +1. The number of nonimbibed
and germinated seeds were recorded every 24 hours during 7 days.
Results are shown in the figure.
Both seeds populations presented high percentage of hard seeds
(more than 95%). Both responded in similar way to the treatments
applied. Seeds soaking in concentrated sulphuric acid for 2030
minutes and mechanical scarification were the most effective treatments.
Germination accumulated for 7 days was more than 90%, using the
mentioned treatments. Scarification using sulphuric acid for 10
minutes was only partially effective. Germination was better than
the control but worse than the one obtained with the other procedures
(LSD, 1% level). Seeds which did not germinate at all were visibly
not imbibed up to the moment the evaluation ended.
References
Brown CS (1955) Hard seed in birdsfoot trefoil. Unpublished PhD
thesis, Cornell University. Ithaca, New York
Hopkins EF (1923) The behavior of hard seeds of certain legumes
when subjected to conditions favorable to germination. Proc Assoc
Off Seed Analysts N Amer 14: 4648
MacDonald HA (1946) Birdsfoot trefoil (Lotus corniculatus
L.). Its characteristics and potentialities as a forage legume.
Cornell University Agriculture Experimental Station.
Minon DP, GH Sevilla, L Montes and O Fernandez (1990) Lotus
tenuis: Leguminosa forrajera pare la Pampa Deprimida. Boletin
Tecnico Est Exp Agr Balcarce N° 98:8.
Mujica MM and CP Rumi CP (1991) Estado de dureza en las semillas
de Lotus tenuis: efecto de las condiciones de conservacion.
Rev de la Fac de Agr, Univ Nac de La Plata, 66/67: 6366.
Nikolaeva MG (1969) Physiology of deep dormancy in seeds. IPST
Press Jerusalem 220 pp.
Rolston MP (1978) Water impermeable seed dormancy. The Bot Rev
44: 365396.
The low seedling vigor of L. tenuis restrict their success
to establish, especially in the case of intersowing at a
natural field. Some factors from the environment taking place
at certain seasons or places are not favorable for a rapid and
effective germination and can cause failure or delay in seedling
emergency. If, under the same conditions, other species and weeds
are not affected for those factors, then L. tenuis will
be in disadvantage as regards competitive capacity.
Temperature is often considered one of the main factors acting
in the environment because of its influence on the germination
rate (Garcia Huidobro et.al., 1982). Qualls and Cooper (1968)
proved that the germination rate in most of varieties tested of
L. corniculatus increased as temperature went up from 15.6
to 21.1 °C. Only one of the varieties showed a significant
increase up to 26.7°C. Woods and MacDonald (1971) pointed
out that germination of L. corniculatus was delayed under
temperatures lower than 15°C and, not only delayed but also
reduced under temperatures of 30°C and higher. In a variety
of the same species, Hurt and Nelson (1985) determined that 20°C
is the temperature under which the highest percentage of final
germination takes place.
The coefficient of association between L. tenuis and
L. corniculatus according to Grant and Zandstra (1968)
suggested there should be similarity for these species in many
traits. Nevertheless, L. tenuis germination behavior with
respect to temperature has not been informed yet. Such information
would be valuable to identify the best moment for sowing and to
study the possible relationship with adaptation mechanisms.
The aim of this paper was to evaluate the dynamic of L. tenuis
germination under three different constant temperature treatments
(17°C +1; 21°C +1 and 25°C +1). The biological
material used for this study consisted of seeds from two natural
populations and two improved populations, harvested in December
and January. Seeds from natural populations were collected in
Brandsen and Magdalena, Province of Buenos Aires, Argentina. Improved
populations were "Tresur Chaja" and "Los Hornos".
Seeds from both populations were collected from free polinization
lots at "Julio Hirschhorn Experimental Field" in Los
Hornos, Province of Buenos Aires.
Each treatment was repeated four times under a completely randomized
design. Fifty seeds were placed into petri dishes, on filter paper,
under standard humidity conditions. Seeds were previously scarified
using concentrated sulphuric acid for 20 minutes. Seeds were observed
two times diary during one week. Germinated seedling were counting
and remove when radicle lengths were of 2mm or more. Germination
percentages were arcsin transformed before analysis of variance.
Results are shown in Figure 1. They
indicate that temperature of 25°C was the less favorable
one. Natural populations were negatively affected as regards speed
of germination but not as regards final cumulative germination
at 108 hours of imbibition; while in the varieties both parameters
were affected. The temperature of 21°C had a positive effect
on the speed of germination of the every populations studied.
At 24 hours germination percentage was higher at 21°C than
the recorded for temperatures of 17°C and 25°C. This
effect was not observed for the final germination results, when
compared treatment at 21°C with treatment at 17°C.
Temperatures of 25°C or higher will cause delay in seedling
emergency, especially in the case of the varieties studied. This
will obviously restrict establish success if the sowing is in
seasons when such temperature is usual. The behavior of the germination
at 17°C indicate that the L. tenuis early sowing in
Spring or late in Autumn could be interesting alternatives to
investigate.
References
Garcia Huidobro J, JL Monteith and GR Square, 1982. Time, temperature
and germination of pearl millet. J Exp Bot 33, 288296.
Grant WF and Zandstra II, 1968. The biosystematics of genus Lotus
(Leguminosae) in Canada. II Numerical chemotaxonomy. Can J of
Botany 46, 585589.
Hurt SN and CJ Nelson, 1985. Temperature effects on germination
of birdsfoot trefoil and seombadi. AgronJ77, 557560.
Qualls M and CS Cooper, 1968. Germination, growth, and respiration
rates of birdsfoot trefoil at three temperatures during the early
nonphotosynthetic stage of development. Crop Sci 8, 758760.
Woods LE and HA MacDonald, 1971. The effects of temperature and
osmotic moisture stresses on the germination of Lotus corniculatus.
J Exp Bot 22, 575585.
Introduction
"Broadleaf birdsfoot trefoil" and "narrowleaf birdsfoot
trefoil" are the most important species (cultivated and naturalized)
in Argentina.
Our purpose was to study anatomical features of L. corniculatus
and L. tenuis leaves. These characters would be used
in plant pathology and ecological research.
Materials and Methods
Leaves from plants growing in pots were used. Our acknowledge
to M. M. Mujica, Area de Genetica, Facultad de Ciencias Agr. y
For., U.N.L.P., who provided the L. tenuis material.
For epidermis in surface view studies, each central leaflet from
fresh leaves was attached to glassslide with double adhesive
tape; fine forceps were used to remove the epidermis (peeling
technique); it was mounted in glycerin 90%.
Epidermal characters on leaflets adaxial and abaxial surfaces
were examined using a Leitz light microscope. Measurements of
stomata! size were obtained using a Nikon light microscope equipped
with a micrometer.
For SEM studies, FAAfixed leaves were dehydrated in absolute
alcohol, placed between glassslides and silica geldried,
then, central leaflets were mounted on stubs with double adhesive
tape and sputtercoated with goldpalladium. Observations
on both surfaces were made at 15Kv with a Jeol JSMT100 scanning
electron microscope.
Observations of the leaf structures were made on the basis of
microtome sections using fixed material in FAA. For microtoming,
fixed material was dehydrated through an alcoholic series. Transverse
sections were cut at 1015 1lm thickness with a rotary microtome,
following standard paraffin methods. Sections were stained with
cresylviolet 1% (me/achromatic), then mounted on glassslides
with balsam.
Results
L. corniculatus and L. tenuis showed epidermal cells
with undulate walls and different sizes in surface view; they
are elliptic in crosssection; sunken and elliptical stomatas
with wide and raised outer stomata! ledge (rim), aperture long
and narrow, were found; they are distributed in a random manner
and surrounded by 3 or 4 epidermal cells which form a triangular
or trapezoidal space over them.
Mesophyll consists the cells irregular in shape and separated
from one another by an extensive system of intercellular airspaces;
these cells constitute the spongy chlorenchyma. Tannins and some
crystalifer cells were found.
In L. corniculatus only few simple, long and thin trichomes
were found on the leaflets, but another shorter may be found on
the rachis and peciolules.
Table 1. Stomata size (µm)and stomata number per unit of area of leaflet surface (mm-2)
L = long
W = wide
Conclusions
Both Lotus species present amphistomatic and homogeneous
leaflets with sunken stomatas; they are predominantly on the adaxial
surface. L. tenuis showed stomatas shorter than L. corniculatus,
but the stomata number per unit of area of leaflet surface was
greater.
L. tenuis showed epidermis
with external cells walls more convex than L. corniculatus,
and after treatment for SEM, this differences continued.
Removal of epidermal layer in L. tenuis was easier than
L. corniculatus.
Epidermal cells showed undulate walls in different grades on both
leaflet surfaces.
Some leaflets from L. corniculatus showed mesophyll with
palisade and spongy tissue becoming distinguishable from one another.
Note: the data reported are the basis to continuous our
research using plants growing under different conditions.
Literature
FREEMAN, H.E. 1984. Leaf histologytwo modern methods. Journal
of Biological Education 18 (4):271272.
METCALFE, C.R. and L. CHALK. 1979. Anatomy of Dicotyledons. Vol.1
and 2. Oxford Clarendon Press.
MOORE, A.J. and N.R., LERSTEN. 1972. Leaf crystals of Psoralea
(PapilionoideaeLeguminosae). Brittonia 24:124.
Lotus corniculatus var. japonicus Regel has been
found through many parts of Korea. Nevertheless, the species seems
not quite successful to establish itself in the peninsular part
of the country, considering the scattered distribution and limited
size of colonies (Moon 1992). However, many large colonies have
been found in the Cheju Island (once known as Quelparta in Europe),
which is the largest island and located at the subtropical southern
end of Korea The spacious grasslands, mild winter temperature
and abundant pollinators may be also the factors supporting such
successful colonizations in the island.
It was once mentioned that wild populations in the island should
have intermingled with alien L. corniculatus that were
introduced as a fodder crop for horses and cows, and that were
subsequently escaped from cultivation (MOOn & Kim 1992). As
a result of inbreeding between heterogeneous strains, many different
types of the plants have been found from various aspects of morphology
and phytochemistry (Moon,1992).
To trace a mechanism to maintain the populations, I investigated
with a prior interest in 1992 about what kinds of insects were
associated with L corniculatus var. japonicus in
Cheju Island. Frequent and active visitors were found distinctively
in Hymenoptera. Out of 12 hymenopteran species, two groups of
bees Apis mellifera L. and Megachile spp. were detected
as the most frequent visitors to the flowers. They were also important
pollinators through a year.
The populations of the honey bee mellifera were also of
heterogeneous oirgins because they were annually imported for
honey production and also as pollinators for glasshouse agriculture
largely from Canada and Australia, and recently from China and
New Zealand. However, the countries have also imported or exchanged
the strains of mellifera between them or from the other
sources. It is, therefore, hard to detect which strains of A.
mellifera are most closely associated with the plants. But
the bees of a slightly darker and pubescent populations were the
most abundant and frequent visitors on the flowers of L corniculatus
var. japonicus. As far as I understood, such characters
are those of Caucassian strains that have usually their territories
in cooler northern part of South Korea. They seem to stay longer
and to enter more deeply into the base of flowers than the other
strains of the bees. While they attend in nectaring, they hold
the tip of flower keels with their middle and hind legs subsequently
making the keels slightly opened. Then the pollens are mixed while
the bees move their wings and thorax touching the tips of keels
(Figure 1A).
Megachile identified are M. humilis Smith, M.
analis Nylander and M. bicolor kigiana Cokerell, but
another 3 species were remained unidentified. The densely haired
abdomens of Megachile species were most useful tools for
mixing and exchanging pollens between the keeled flowers of leguminous
plants (Figure 1B). They hold and
press the base of flower keels during nectaring, which then became
naturally opened slightly. Then the hairs of abdomen touch the
keels as if they brush the keels.
The next groups of visitors, but less frequent, were largely found
between bumble bees. They are, in turn of visiting frequencies,
Bombus ardens ardens Smith, B. koreanus (Skorikov),
B. ussurensis Radoszkowski, B. opulentus Smith,
and rarely B. consobrinus wittenburgi Vogt. They used to
stay only short on the plants and often visit simply the flowers
rather rhan collect nectar.
On the other hand, it has been found, other than the hymenopteran
visitors, a small number of aphids feeding on various parts of
L. corniculatus var. japonicus; Acyrthosiphon
pisum(Harris), Megoura viciae coreana (Moritsu), Aphis
craccivora Koch, A. fabae Scopoli, A. gossypii Glover,
Sitobion spp. However, a large number of hunters and parasites
such as ladybeetles, polispine, eurytomid and braconid wasps were
found wandering between vegetation of L corniculatus var. japonicus.
Ladybeetles are often observed feeding on the small herbivores.
Among them, routinely found and identified are Coccinella septempunctata
'L., Henosepilachna vigintiotopunctata (F.), Serangiurn
japonicum Chapin, Scymnus spp.. They seem to be related
with the aphids feeding on L. corniculatus var. japonicus
but it has not been investigated why so many kinds of parasitic
and hunting wasps visit L. corniculatus var. japonicus.
It should be interesting to study because they are unlikely to
find their hosts or preys successfully on the plants.
Moon, T.Y. 1992, Cyanogenic polymorphism in the leaves of Lotus
corniculatus var.japonicus Regel (Leguminosae) in
South Korea, Korean J. Ecol. 15 (1):7580
Moon, T.Y. & J.H. Kim, 1992, The distribution records of
Lotus corniculatus var. japonicus Regel in Korea, Lotus
Newsletter (USDA) 23:2428
Last year in the Lotus Newsletter (Grant et al. 1992),
a birdsfoot trefoil plant was reported in which the inflorescence
was sessile and which had only a single inflorescence per individual
branch. It was planned to carry out crosses to obtain inheritance
data, as no mutant plant possessing a sessile inflorescence had
been reported previously.
During the fall of 1992, seed was germinated from the sessileflowered
putative mutant and seedlings were raised in the greenhouse. The
plants were brought into flower through the use of mercury lights
which provided a daylength of approximately 17 hours. When the
plants came into flower, the flowers arose on axillary peduncles
as on normal birdsfoot trefoil plants. Further seed was germinated
and seedlings transplanted to the field during the summer of 1993.
All putative mutants grew normally producing normal inflorescences.
In addition, the original plant which had remained in the field
during the winter produced normal branches and flowers during
the summer of 1993.
It is assumed that a physiological condition arose during the
initial development of the putative mutant plant which was not
inherited. This led to normal growth in subsequent growth of the
plant and to normal growth in succeeding generations.
Acknowledgment
Financial support from the Natural Sciences and Engineering Research
Council of Canada to W. F. Grant for studies in birdsfoot trefoil
is gratefully acknowledged.
Reference
Grant, W. F., McDougall, R. B. and Coulman, B. 1992. Sessile inflorescence
A putative new mutant in birdsfoot trefoil. Lotus
Newslett. 23: 1113.
The callus protoplasts of cv. Viking were isolated by 4% Cellulase
Onozuka RS, 1% Macerozyme R10, 0.2% Pectolyase Y23
and 0.1M mannitol. The isolated protoplasts (1 x 104 / ml) were
cultured in a thin layer of KM8p medium (Kao and Michayluk, 1975).
The medium was solidified with 0.6% agar. After 1 month they developed
into globular colonies. The colonies derived from single protoplasts
could be detected by continuous observation using an inverted
microscope. The induced callus lines, all of which were derived
from single protoplasts were transplanted to MS medium (Murashige
and Skoog, 1962) with 1.5 mg / 1 IAA and 1.5 mg / 1 BA. One of
the callus lines that produced numerous shoots was used in this
experiment, and their shoots were transplanted to the medium of
Nitsch and Nitsch (1969), without growth regulators, for the formation
of complete plantlets.
The regenerated plants originated from a single protoplast mostly
showing 24 chromosomes, indicative of their tetraploid nature.
Among 71 regenerated plants, there was only one octoploid and
one mixoploid, which had cells with 24 (tetraploid) and 48 (octoploid)
chromosomes. No aneuploids were observed and chromosome structural
changes were not detected under a light microscope.
In the meiosis of seedderived plants, a very small number
of PMCs showed abnormalities such as the univalent at metaphase
I and lagging chromosomes at anaphase I. The protoclones, on the
other hand, showed a high frequency of meiotic abnormalities,
although abnormal somatic chromosomes were not found under a light
microscope. The abnormal chromosome set that appeared most frequently
at metaphase I generally contained one or two univalents. At diakinesis,
asynaptic chromosomes were also occasionally observed. These may
have occurred due to deletions or translocations. In anaphase
I and II, bridges and fragments were frequently observed. These
may have arisen from a crossover within the inversion. The frequencies
of bridges and fragments varied among the protoclones. Besides
these chromosome alterations, lagging chromosomes were frequently
observed at anaphase I and II. Occurrence of these abnormal chromosome
configurations at meiosis seemed to be one of the causes of the
decrease in pollen fertility. Indeed, higher frequencies of the
chromosome abnormalities tended to relate to lower pollen fertility.
Generally, the chromosome abnormalities such as univalents, lagging
chromosomes, fragments and bridges at meiosis largely decreased
in the protoclones of two succeeding generations (P2 and P3) after
open pollinations of the regenerated protoclones (P1). This may
be caused by the elimination of gametes with abnormal chromosome
configurations. Indeed, it was observed that the pollen fertility
drastically increased in the P2 and P3.
References
1. Kao. K.N. and M.R. Michayluk. 1975. Nutritional requirements
for growth of Vicia hajastana cells and protoplasts at
a very low population density in liquid media. Planta 126:105110.
2. Murashige. T. and F. Skoog. 1962. A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol. Planta. 15:473497.
3. Nitsch J.P. and C. Nitsch. 1969. Haploid plants from pollen
grains. Science 163:8587.
Cell Manipulation Group, AFRCInstitute of Grassland and
Environmental Research, Aberystwyth Research Center, Plas Gogerddan,
Aberystwyth, Dyfed, SY23 3EB, UK.
Lotus corniculatus is an important species in managed pasture
systems and in addition may be regarded as an interesting forage
legume for laboratory experiments. In particular, L .corniculatus
can be readily transformed with Agrobacterium rhizogenes
to produce 'hairy root' cultures; on exposure to light these
root cultures regenerate to produce transgenic plants (Webb et
al., 1990).
A. rhizogenes strains which harbour binary transformation
vectors, can be used to introduce novel gene constructs into L.
corniculatus. During this procedure, a number of cotransformation
events are found in which TDNA from the binary vector is
transferred to the genome of a recipient Lotus genotype.
At IGER we have been using this system to introduce sense and
antisense genes into L. corniculatus. However, we have
encountered problems in determining the presence of the introduced
transgenes due to difficulties in extracting good quality genomic
DNA from this species (Robbing et al., 1991). Although
we can conveniently monitor for the presence of selectable antibiotic
markers, for example, kanamycin or hygromycin resistance encoded
in the TDNA of a binary vector; this is an indirect method
for detecting linked sense or antisense gene construct sequences.
In view of the difficulties outlined above, we have assessed the
possibility of using the polymerase chain reaction (PCR) to detect
betaglucuronidase (gus) sequences in the genome of a Lotus
line cotransformed with pJIT73, a binary vector containing
a gus gene together with hygromycin and kanamycin selectable markers.
In addition, we include data on the detection of gus sequences
and GUS activity in the progeny of this cotransformed line.
Materials and methods
The original plant material (line JIT73/12) was produced by transformation
of Lotus corniculatus cv. Leo with A. rhizogenes LBA
9402 harbouring pJIT73. Progeny were produced by handcrossing
to nontransformed plants using the transformed plant as
the male parent. A full description of this plant line is given
in Webb et al. (1994).
Genomic DNA was isolated from Lotus plants grown either in a transgenic growth room or transgenic greenhouse facility using our previously described method (Robbing et al., 1991).
PCR reactions were carried out on a PerkinElmer Thermal
Cycler 480.
Each reaction contained in a volume of 100µl: 60µl PCR
reaction buffer [16.6mM Tris pH 8.4, 83.3mM KCl, 25mM MgCl2,
0.17mg/ml gelatin], 10µl Oligo 1 [100µM], 10µl
Oligo 2 [100µM], 10µl deoxynucleotides [2mM], l0µl
Lotus genomic DNA [100ng], 0.5µl AmpliTaq DNA
polymerase [2.5 Units].
Reactions were run in 0.5ml microcentrifuge tubes and the reaction
mix was overlaid with 100µl liquid paraffin. Primer sequences
used in this study were; Oligo 1 GGTGGGAAAGCGCGTTACAAG and for
Oligo 2 GTTTACGCGTTGCTTCCGCCA corresponding to 5' and 3' sequences
in the gus gene. This primer pair was designed to give a PCR amplification
product of about 1.2kb (Hamill et al., 1990). PCR reaction
buffer and plasticware were autoclaved before use while oligonucleotides,
deoxyoucleotides and genomic DNA were made up either in sterile
water or sterile l0mM Tris, lmM EDTA (TE). All liquid transfers
were carried out using a positive displacement pipette.
We used the following cycling conditions for overnight PCR runs:
94°C, 3 minutes, 10 cycles of; 94°C, 1 minute; 45°C
1 minute; 72°C 1.5 minutes, 25 cycles of; 94°C, 1 minute;
45°C 1 minute; 72°C 2.5 minutes, 20µl of reaction
products were run on a 1% agarose gel and visualized with ethidium
bromide. After photography gels were alkaline blotted onto Zetaprobe
membrane and then probed with a gus DNA sequence isolated from
pA1GusN (Klein et al., 1988). Filters were placed in autoradiography
cassettes with two intensifying screens and developed after overnight
exposure at 70°C.
Results from the analysis of line Jit73/12 and progeny
When amplification products from JIT73/12 genomic DNA were run
out on an agarose gel and stained with ethidium bromide, we noted
two amplified DNA fragments sized 1.2kb and 450bp. No amplification
products were seen when reactions were run using genomic DNA from
nontransformed Lotus plants. Genomic DNA from seven
of the progeny of pJIT73/12 also yielded 1.2kb and 450bp PCR products.
In order to clarify the results, agarose gels were blotted and
then probed with a gus specific DNA probe. After autoradiography
we found that only the 1.2kb amplification product showed any
hybridization with the gus sequence. Hybridization signals were
noted in a number of samples where there was no visible amplification
by PCR. In one case, line 13, visible PCR products were seen but
gave no hybridization when probed with gus.
Below we have tabulated the PCR data for Jit73/12 and for fifteen
of its progeny. In addition we outline GUS enzyme activity and
hygromycin resistance data for these lines.
| Plant line | Visible PCR
amplification products | qus-positive
after hybridization | GUS activity | Hygromycin
resistance |
| Control | No | - | ||
| pJIT73/12 | + | + + | Yes | HygR |
| Progeny 2 | No | - | ||
| Progeny 3 | + | ++ | Yes | HygR |
| Progeny 4 | + | + + + | Yes | " |
| Progeny 5 | + | Yes | " | |
| Progeny 6 | + | Yes | " | |
| Progeny 8 | Yes | " | ||
| Progeny 9 | + | Yes | " | |
| Progeny 10 | Yes | " | ||
| Progeny 11 | No | - | ||
| Progeny 12 | + | Yes | HygR | |
| Progeny 13 | + | No | - | |
| Progeny 14 | + | ++ | Yes | HygR |
| Progeny 15 | + | ++ | Yes | " |
| Progeny 16 | + | ++ | Yes | " |
| Progeny 17 | + | +++ | Yes | " |
Discussion
Comparison of GUS activities with PCR results indicated that the
first method using ethidium bromide staining to give visible PCR
products underestimated the number of transgenepositive Lotus
plants. However more lines could be scored as gus-DNA positive
after DNA probing and scoring for the presence of a 1.2kb hybridizing
fragment. Both progeny 8 and 10 had measurable GUS activity but
no corresponding PCR product was found, which implies that this
analysis still underestimates the presence of transgenes. However
in this high expressing line (pJIT73/12) we did not note any progeny
which registered positive by PCR but negative by enzyme activity.
Therefore although this method unequivocally identified gus sequences
in the parental plant and its progeny, problems still exist when
it comes to identifying all the transgenepositive plants
presumably due to nonamplification events. We recommend
using a positive control when using PCR for analyzing transgenic
Lotus lines. For example when using A. rhizogenes transformed
material, one option could be to use primers to cotransferred
rol genes as well as primers specific for sequences in
binary vector TDNA.
Acknowledgments
Thanks to Steven Colliver, Andrew Bettany and Leif Scot for helpful
advice on PCR. Also thanks to Teri Evans and Sue Mizen for excellent
technical assistance. Tom Carron was funded by the AFRCPlant
Molecular Biology Initiative (PG 203504). Genetic manipulation
work was carried out under MAFF license. PCR is covered by patent
to Perkin Elmer and all operations should be carried out using
licensed Taq polymerase and on approved thermocycling equipment.
References
Hamill JD, Rounsley S, Spencer A, Todd G, Rhodes MJC, 1990. The
use of the polymerase chain reaction to detect specific sequences
in transformed plant tissues. In: Progress in Plant Cellular
and Molecular Biology, Nijkamp, van der Plas and van Aartrijk
(eds), Kluwer Academic Press.
Klein TM, Gradziel T, Fromm ME and Sanford JC, 1988. Factors influencing
delivery into Zea mays cells by highvelocity microprojectiles.
Bio/Technology 6, 559563.
Robbins MP, Evans TE, Morris P and Carron TR, 1991. Some notes
on the extraction of genomic DNA from transgenic Lotus corniculatus.
Lotus Newsletter 22, 1821.
Webb KJ, Jones S, Robbins M and Minchin FR, 1990. Characterisation
of transgenic root cultures of Trifolium repens, Trifolium
pretense and Lotus corniculatus and transgenic plants
of Lotus corniculatus. Plant Science 70, 243254.
Webb KJ, Robbins M and Mizen S, 1994. Expression of GUS in primary
transformants and segregation patterns of GUS TL and TR DNA in
the T1 generation of hairy root transformants of Lotus corniculatus.
Transgenic Research (accepted for publication).
The usefulness of Random Amplified Polymorphic DNA (RAPD) to distinguish
among different taxa of Lotus was evaluated for several
geographically dispersed accessions of four diploid Lotus
species, L. tenuis Waldst. et Kit, L. alpinus Schleich.,
L. japonicus (Regel) Larsen, and L. uliginosus Schkuhr
and for the tetraploid L. corniculatus L., in order to
ascertain whether RAPD data could offer additional evidence concerning
the origin of the tetraploid L. corniculatus. Clear bands
and several polymorphisms were obtained for 20 primers used for
each species/accession. The evolutionary pathways among the species/accessions
presented in a cladogram were expressed in terms of treelengths
giving the most parsimonious reconstructions. Accessions within
the same species grouped closely together. It is considered that
L. uliginosus, which is most distantly related to L.
corniculatus, may be excluded as a direct progenitor of L.
corniculatus confirming previous results from isoenzyme studies.
Lotus alpinus is grouped with accessions of L.
corniculatus which supports the relationship from a previous
enzyme study in which alleles 6Pgdhl120 and Me2152
are found only in L. alpinus and L. corniculatus
and not in the species L. tenuis, L. uliginosus and
L. japonicus. The findings are in agreement with previous
experimental studies in the L. corniculatus group.
The conservation and utilization of genetic resources are important
international research priorities. To better utilize such valuable
plant materials, detailed knowledge about genetic differences
among individuals or groups of accessions of economically important
species is needed to provide a systematic approach for improving
germplasms. Onehundredtwenty-eight of 335 broadleaf
birdsfoot trefoil (Lotus corniculatus L.; 2n =4x = 24)
accessions from the National Plant Germplasm Collection (1) which
were collected from five continents and representing 33 ecoregion
provinces were analyzed. By using biochemical differences in high
salt soluble globulin seed polypeptides, it was found that the
birdsfoot trefoil accessions could be classified into seven genetic
groups that were related to the ecological region in which they
were collected. The seven groups are: 1. Southern Euro highlands,
2. Southern Euro lowlands, 3. TransEuro lowlands, 4. Asia
minor highlands, 5. WestEuropeanNorth African, 6.
Ethiopian, and 7. FrenchMediterranean. Unique morphological
characters that had not been previously described were associated
with some of the groups.
It also was found that many of the cultivars that are now available
to consumers were derived from a narrow germplasm base, therefore,
much of the genetic variation in the collection is still available
for unique germplasm and cultivar development. The biochemical
and ecological classification approach used in this study may
provide a useful way to examine other germplasm collections, and
point to how different germplasm bases may be improved. Such biochemical
and ecological interpretive methods may also show where to collect
accessions that are less likely to be related to ones that have
been previously collected and that are already in germplasm collections.
For detailed information about this research, see: J.J. Steiner
and C.J. Poklemba. 1994. Lotus corniculatus classification
by seed globulin polypeptides and relationship to accession pedigrees
and geographic origin. Crop Science 34:255264; or write
to: J.J. Steiner, National Forage Seed Production Research Center,
USDAARS, 3450 SW Campus Way, Corvallis, OR 97331.
(1) Inquiries concerning the acquisition of accessions should
be addressed to: Dr. Stephanie Greene, Plant Genetic Resources,
USDAARS, NYS Agricultural Experiment Station, Geneva, NY
14456.
STEPHANIE L. GREENE, FORAGE CURATOR, AND MARK BOHNING, CAC FACILITATOR
USDA, ARS Plant Genetic Resources Unit, Cornell University, Geneva,
New York, 14456 and USDA,ARS National Germplasm Resources Laboratory,
Beltsville, Maryland 20705.
Introduction
The USDA, ARS National Plant Germplasm System (NPGS) is a network
of federal, state, and private organizations dedicated to conserving
and utilizing the genetic diversity of plant species we rely on
for food, fiber, medicine and industrial products. The NPGS is
mandated to acquire, maintain, characterize, evaluate and distribute
genetic resources for present and future use. Overall, 441,000
accessions are held, representing current and obsolete cultivars,
landraces, wild/weedy relatives and genetic stocks. The NPGS Lotus
collection contains 737 accessions, representing about 40
species (Table 1.).
The Germplasm Resources Information Network (GRIN) is the centralized
database housing systemwide information on collection inventories
and accession passport, taxonomy and evaluation data. Seed and
information requests are also processed through GRIN. It was developed
by the NPGS Database Management Unit and is maintained by that
group in Beltsville, Maryland. Public users can access GRIN directly
via a modem or through the internet where they can view accession
information and request seed or additional information. A crop
specific PCbased version of GRIN, called PCGRIN was developed
specifically to assist public users in selecting desirable accessions
within the collection. The purpose of this article is to introduce
collection users to the features available on PCGRIN and
ultimately to encourage ~e of the collection.
PCGRIN can be run on an IBMcompatible personal computer.
The Lotus database requires 2.5 megabytes of hard drive
space. The GRIN Database Management Unit is currently developing
a Macintosh version which should be available mid1994. PCGRIN
users also receive a quarterly newsletter containing information
on user tips, program changes and version updates. The software
is menudriven and comes with complete documentation so the
program is easily understood. At the main menu the user can select
from the following choices: SELECTION, ACCESSION, TAXONOMY, GRIN
STATISTICS, and DIRECTORY.
| angustissimus | 8 |
| arabicus | 1 |
| arenarius | 11 |
| chihuahuanus | 1 |
| collinus | 13 |
| conimbricensis | 7 |
| corniculatus | 400 |
| creticus | 18 |
| cytisoides | 4 |
| denticulatus | 1 |
| digit | 2 |
| discolor | 2 |
| edulis | 11 |
| gebelia | 2 |
| glaucus | 2 |
| glinoides | 1 |
| grandiflorus | 1 |
| greened | 1 |
| halophilus | 2 |
| hybrid | 2 |
| mearnsii | 2 |
| maroccanus | 15 |
| nevadensis | 1 |
| oblongifolius | 1 |
| ornithopodioides | 21 |
| palustris | 6 |
| parviflorus | 5 |
| pedunculatus | 2 |
| peregrinus | 9 |
| species | 29 |
| subbiflorus | S |
| subpinnatus | 3 |
| tenuis | 43 |
| uliginosus | 89 |
| unifoliolatus | 12 |
| weilleri | 4 |
Selecting Accessions using the SELECT option
In the SELECTION area of PCGRIN, the user can select Lotus
accessions based upon accession information such as country
of origin, latitude, longitude, habitat and other passport information.
Table 2 lists the accession information available
in the Lotus collection. Observations of morphological
traits, relative response to environmental stress and chemical
and genetic composition can also be used to select accessions.
The Lotus collection has been evaluated for 20 descriptors
to date (Table 3). Additional characters will
be added to the database as evaluation studies are carried out.
Using PCGRIN, the public user interested in developing a
cultivar with exceptional winter hardiness can select an array
of potentially useful material by specifying a high degree of
winter hardiness (as measured at Geneva, New York, USA)! or by
specifying a range of elevations and latitudes or origin. Once
a subset of accessions has been selected, all relevant information
can be displayed and printed or the subset can be further refined
with additional criteria. Specific accessions can then be requested
from the Forage Curator.
Collection users need to be aware of the limitations of the database.
Minimal information is available for some accessions. Recently
collected accessions generally have more extensive passport information.
Efforts are underway to assemble and place outstanding accession
information into the NPGS database to be made available to public
users in updated versions of PCGRIN. Evaluation and characterization
data has been collected on most, but not all accessions. Table 2 lists
the percentage of Lotus corniculatus accessions evaluated
to date, for each descriptor trait. Common cultivated species
are generally more thoroughly evaluated than less common or wild
species.
A substantial portion of the observation data were collected at
Geneva, New York over the last forty years. The data represent
single replications of 20 plants. The user needs to be aware that
accession ranking could be confounded by a year effect. Generally,
the evaluation environment is described for the set of traits
observed. Collection users can use this information to gauge the
robustness of the data. Although historical observation data has
limitations, it can still be used by the cognizant curator or
public user to assemble a subset of accessions that have a greater
probability of containing alleles of interest then if the subset
was assembled by random sampling.
Retrieving information using the ACCESSION or TAXONOMY option:
The ACCESSION option allows the user to quickly retrieve all available
information on an accession (Table 3.). This
information includes: place of collection, collector or developer
name, address and narratives, donor information, cultivar and/or
local name, current taxonomy, evaluation data, comment fields
and inventory availability. The data can be retrieved by using
a Plant Introduction (PI) number (primary identifier used by the
NPGS) or secondary identifier (such as the inventory identifier
of another genebank, or original collector number). The local
or cultivar name, genus or genus and species name can also be
used.
The TAXONOMY section in PCGRIN provides the user with complete
taxa information for a given species. Information is available
on complete scientific name and authority, common name, species
synonyms, species citations, species distribution, family name
and literature citations. It also specifies how many accessions
are available for a given species. The data can be retrieved by
using a genus name, binomial, trinomial, synonym or common name.
Information available in the GRIN STATS and DIRECTORY areas of
PCGRIN
The GRIN STATS area of the PCGRIN database provides the
user with general summary information about the NPGS and specific
crop collections. The user can choose from 6 summary reports which
are further described in Table 4. The DIRECTORY
option in the database provides the user with a directory of NPGS
organizations. This includes names and addresses of staff members
at germplasm maintenance sites, members of Crop Advisory Committees
and other relevant committees and organizations which make up
the NPGS.
Conclusion
Ready access to comprehensive collection documentation promotes
the conservation and utilization of genetic resources. PCGRIN
provides an easytouse tool which gives the collection
user comprehensive information about the NPGS Lotus collection.
The software is available free of charge from the GRIN Database
Management Unit in Beltsville, MD and can be obtained on floppy
disks or over the Internet. Requests and further information can
be obtained from:
Database Manager
GRIN Database Management Unit
USDAARSPSINGRL
Building 003, Room 407, BARCWest
Beltsville, Maryland 207052350
Phone: 3015045666
Fax: 3015046305
| General information | Explanation |
| NPGS identifier prefix (PI or G) |
| Accession number | NPGS unique identifier number |
| Accession suffix | NPGS identifier suffix used to identify selections within an accession |
| Seed availability | Inventory availability |
| Secondary ID | Last previous identifier assigned to accession |
| Cultivar | Cultivar name |
| Local name | Traditional name of accession |
| Improvement status1 | Relative improvement status of accession, such as wild, land race etc. |
| Year collected | Year accession was collected |
| Collector/ Developer | Name and institute of individual who collected or developed accession |
| Origin | Country where accession originated |
| Latitude | Latitude degrees, hemisphere and minutes where accession was collected |
| Longitiude | Longitude degrees, hemisphere and minutes where accession was collected |
| Elevation | Site elevation where accession was collected |
| Habitat | Description of ecosystem where accession was collected |
| Locality | General locality where accession was collected |
| Accession narrative! | Information and comments from collector, developer or donors |
| Site narrative' | Information and evaluation comments from NPGS maintenance site |
| Donor name, institute | N |
